isla5662 isla5662
  • 12-04-2024
  • Chemistry
contestada

Which energy source would be most affected by the depletion of water from rivers and streams?

Respuesta :

trinityricci1968 trinityricci1968
  • 12-04-2024
Hydroelectric power relies on the flow of water to generate electricity,
Answer Link

Otras preguntas

What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
Give a recursive algorithm for finding the sum of the first n odd positive integers.
Graph the first six terms of a sequence where a1 = -10 and d = 3.
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
I want to work with LDAP. what is LDAP?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
Help pl0x, Algebra 1
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup