shaking9230 shaking9230
  • 04-07-2017
  • Mathematics
contestada

If it takes you one hour and 45 minutes to drive 105 miles, find your average speed. be sure to label your answer fully

Respuesta :

texaschic101
texaschic101 texaschic101
  • 04-07-2017
1 hr and 45 minutes = 60 min + 45 min = 105 minutes

105 miles / 105 minutes = 1 mile per minute
Answer Link

Otras preguntas

What kind of problems did increased urbanization cause? During time of industrial revolution
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
Solve the equation -10 + 3x + 5x = -56 ? ??
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What Role Does the Sun Play in Producing Winds And Ocean Currents
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage