jodiecarnrite jodiecarnrite

02-06-2017
Biology

contestada

In the respiration equation, does energy act as a reactant or a product?

Respuesta :

rossross99 rossross99

02-06-2017

Energy and water are products in the respiration equation. On the other hand, the reactants in the equation would be glucose and oxygen.

Answer Link

Otras preguntas

Someone help please!!

−9 1/9 round to the nearest 100th

how does the sense of belonging help to develop a good society?

Can someone find The volume of the shaded portion of the cylinder??????????????????????? I have attached the picture

2^n-5×5^n-4=5Please help me I will mark as brainistplease do the sum in a paper and post...

discuss the role of UNICEF in solving our social problem .

Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t

What would the answer be ?

Which statement is false? 0.8 = 3/5 2/3 > 0.34 2.375 > 2 1/4 3 8/11 < 3 12/13

The small intestines of cows are similar in general structure and function to the small intestines of humans. In a cow, damage in the wall of the small intestin