benjaminmcinnis
benjaminmcinnis benjaminmcinnis
  • 04-04-2022
  • Mathematics
contestada

The equation y=37.8xy=37.8x represents the number of miles, yy, that Julian can drive his car for every xx gallons of gas. Find the rate of change.

Respuesta :

adioabiola
adioabiola adioabiola
  • 06-04-2022

The rate of change of Julian given the equation y = 37.8x is 37.8

How to find the rate of change

The equation:

y = 37.8x

where,

  • y = number of miles that Julian can drive
  • x = gallons of gas used
  • 37.8 = constant = rate of change

If x = 3 gallons

y = 37.8x

= 37.8 × 3

y = 113.4 miles

Learn more about rate of change:

https://brainly.com/question/8728504

Answer Link

Otras preguntas

a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Fossils are most commonly found in which type of rock?
What is the difference between "Herr" and "Herrn"?
_______ is the largest continental biome. It experiences long, cold winters; short, mild summers; and low precipitation. It is characterized by coniferous fore
who fought against each other in the crusades?
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October