Lisbeth07072003
Lisbeth07072003 Lisbeth07072003
  • 16-02-2022
  • History
contestada

How does party affiliation influence law making

Respuesta :

oceanbluemonkey oceanbluemonkey
  • 16-02-2022

Answer:

Party affiliation makes people vote on party lines.

Answer Link

Otras preguntas

Everyone in the neighborhood has been complaining about the deteriorating condition of the park, but nobody has cleaned it up. why not
A federal program that guarantees benefits to qualified recipients is a(n) ________ program
what are the zeros of the function? f(x)=+-6x
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
describe five ways to set strategy for effectively gathering patients information
A mixture from which some of the particles settle out slowly upon standing
i will mark as brainiest you answer this easy question
please answer this im dying here
What is the lowest level of measurement that a median can be computed?
A promissory note Question 12 options: is a written promise to pay. is an oral promise to pay. entitles the maker to a discount. is due in 30 days.