amandascuman456 amandascuman456
  • 02-11-2021
  • Physics
contestada

What shape is the graph produced by a force vs acceleration graph?

Respuesta :

dominic691442 dominic691442
  • 02-11-2021

Answer:Direct students to notice the shape of the force graph (horizontal line) and acceleration graph are the same, but the velocity vs. time graph is a line with a positive slope. A constant forward force produces an increasing velocity and a constant acceleration.

Explanation:

Answer Link

Otras preguntas

Through what system is glucose delievered to cells for cellular respiration
Triangle ABC has side lengths: AB = 3.5 cm, BC = 2.4 cm, and AC = 4.2 cm ΔABC ≅ ΔHJK What is the length of side HJ? HJ = ______cm
There are only three types of polygons that can be the faces of a Platonic solid. They are _____, _____, and _____. Check all that apply. A. rectangles B. squar
Why did some americans feel that the united states should help europe after world war ii?
William Blake believed that it was necessary to A. use experience as the pathway to God. B. eradicate evil from the human condition. C. fear darkness or lose
Find 8 + 35 + (-76).
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Can you help me to find this answer, please, I need help
a chef uses 4 3/4 cups of broth for 10 servings of soup. How much broth is used In one serving
In a standard normal curve, what percentile corresponds to a z-score of 2.0?