joyceannecasulla06 joyceannecasulla06

03-10-2021
Mathematics

contestada

what is the solution of c² + 9 = 9

Respuesta :

only1jacobadam only1jacobadam

03-10-2021

Answer:

The answer is 0

Step-by-step explanation:

0^2 is just 0x1 so 0+9=9

Answer Link

ciara2001 ciara2001

03-10-2021

The answer is zero because 0+0=0+9=9

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

punctuated equilibrium definition biology

What major events led to the establishment of the navy and the department of the navy?

Why did some americans feel that the united states should help europe after world war ii?

Which type of bone has the least amount of spongy bone relative to its total volume?

what played a great role in the kansan nebraska act

what does the constitution state about the interaction of the judicial branch and new laws

A circular swimming pool has a diameter of 12 feet. What is the circumference the pool? Use 3.14 to approximate for π . Enter your answer, as a decimal rou

Which factor played a role in the sudden drop after 1928? A. Lack of demand B. Lack of supply C. Lack of credit D. Lack of income

Can things of aluminum have a greater mass than things made of iron?