SoulessKidd999
SoulessKidd999 SoulessKidd999
  • 02-09-2021
  • Mathematics
contestada

what is 9.1247x10^10

Respuesta :

anshu78 anshu78
  • 02-09-2021

Answer:

91,247,000,000

Step-by-step explanation:

Pls follow me and Mark as brainliest Plsssssssss

Answer Link

Otras preguntas

Which of the following is equivalent to | − 12 + 3 | ?
explain what the benefit of the NFC specification is, by briefly explaining how and why one would make use of this feature in this context
ources 12. What's the area of the triangle below? Foster.edu 8 m, 6 m O A. 24 square meters O B. 96 square meters O C. 48 square meters O D. 7 square meters
In the diagram below, angle 7 equals 61°. What is the measure of angle 8?
He takes a random sample of 49 recent charterholders and computes a mean salary of $172,000 with a standard deviation of $35,000. Use this sample information to
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
As a landlord, what will you most likely need to insure? A. Contents of the building B. The building itself C. Both contents and the building D. None of the abo
Ju Wenjun is an ecologist who studies the change in the tiger population of Siberia over time. The relationship between the elapsed time ttt, in years, since Ju
Forty eight feet equals how many yards?
what is the family of the animal that is land dwelling and uses scent glands for defense