kaydenjhh kaydenjhh
  • 02-08-2021
  • Mathematics
contestada

Algebra 1 need help fast

Algebra 1 need help fast class=

Respuesta :

Аноним Аноним
  • 04-08-2021

Answer:

1st option

Step-by-step explanation:

at the 3rd hour, the money was $100

At 7th hour, the money increased to $160

Now, the rate is,

(160-100)/(7-3)

= 60/4

= 15

so, $15 per hour

Answer Link

Otras preguntas

_____ is a poor conductor of heat. A. Aluminum B. Iron C. Ceramic D. Zinc
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
What are the shantytowns where homeless people lived that President Hoover was mocked about?
Can someone answer my question please if you know the answer Answer choices: F. 1/2 G. 2/5 H. 1/10 J. 3/5
please help find the perimeter
Use the pyramid diagram of the social classes in feudal Japan to answer the following question: Figurehead Emperor Political leader Shogun Nobles Diamyos Wamior
An object’s height is measured in centimeters and in inches. Two rulers, one showing inches, the other showing centimeters. The rulers are aligned at zero. An a
Select all multiples of the number: 9​
PLEASE HELP!!!!!!! What is your favorite thing to do? Also have you wrote a report this year? I will give 10 points
is it A, B,C, or D? i need help asap