Seudónimo Seudónimo

04-06-2021
Mathematics

contestada

Please No LINKS!!! need help asap
Will mark brainllest to who ever gets it right :)

Please No LINKS need help asap Will mark brainllest to who ever gets it right class=

Respuesta :

04-06-2021

The answer is root 10

Answer Link

Otras preguntas

The mean potassium content of a popular sports drink is listed as 138 mg in a 32-oz bottle. Analysis of 40 bottles indicates a sample mean of 136.9 mg. (a) Stat

Read the poem "Nothing Gold Can Stay" by Robert Frost. Nature's first green is gold, Her hardest hue to hold. Her early leaf's a flower; But only so an hour. Th

Alaskan Salmon are fished extensively to serve in restaurants. However, there are limits to how many and the size of fish which are allowed to be kept. Generall

The sum of -6m and -7m is -65

How many ways can a committee of 4 be selected from a club with 12 members?

Find the correct result 1+4 = 5 2+5 = 12 3+6 = 21 5+8 =

the triple alliance of 1882 began when prussia

Marie ______ des photos quand elle voyage. fait est apprend prend

This cylinder is 6 inches tall & has a volume of 60πin^3. Find the area of the cross section

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA