samara124 samara124

03-03-2021
English

contestada

If anyone is good at language skills and wanna get paid 100$ please lmk and pass ur number

Respuesta :

DominiqueMc313 DominiqueMc313

03-03-2021

Answer:

wait just use a website

Explanation:

Answer Link

Otras preguntas

Paul has grades of 86 and 85 on his first two tests. what must he score on his third test in order to have an average of at least 90

The test scores for a group of students are shown. 89, 74, 100, 86, 74, 67, 86, 72, 60, 93, 83, 86 What is the median of the scores?

If 5 potatoes together have a mass of 1 kg and 8 pears together have a mass of 1,200 grams, which has the greater mass, potato or pear? explain.

Los deportistas profesionales ____ el pago por si desempeño. recibe reciben reciban reciba

Decide if the following command is grammatically correct or incorrect. (tu) no digo mentiras.

If a solute dissolves in an endothermic process select one: a. hydrogen bonds must exist between solvent and solute. b. strong ion-dipole forces must exist in t

A penny fell off the top of the building and hit the sidewalk below 3.1 seconds later how many meters did the penny fall to the sidewalk

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

(-6x^3+2x^2-2x)/(2x-1) how do I solve using long division?

Plane ABC and plane BCE ____ be the same plane. Question 4 options: cannot must may