sumimo764 sumimo764
  • 03-01-2021
  • Mathematics
contestada

What is the value of the triangle?
7*= 8*

Respuesta :

absor201
absor201 absor201
  • 04-01-2021

Answer:

The equation will be:

7*8 = 8*7

Step-by-step explanation:

We need to find the values of triangle.

The given equation is:

7*____ = 8*____

It can be solved using commutative law of addition that states that:

[tex]a*b=b*a[/tex]

In the given equation we have:

a = 7 and

b = 8

So, the equation will be:

7*8 = 8*7

Answer Link

Otras preguntas

20% of what number is equal to 2/3 of 90?
Which constitutional amendment allowed voting for citizens who were eighteen or older?
Marco is building a house. he bought lots of wood to make the frame of the house. he wants right angles for his corners. if he uses a piece of wood that is cut
Kira runs 3 miles in 28 minutes. at the same rate, how many miles would she run in 42 minutes
Mi abuelo no es joven. Es _____
While Flinn was starting the fire, his friends were collecting firewood. Flinn has 5 sticks. If he puts 3 sticks in the fire every minute, and his friends bring
__________ is widely considered to be the founder of the professional american police department.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Solve the system algebraically. check your work. 2x + 5y = 10 2x + 3y = 6
help quick please!! Thanks