thatanimeweeb27 thatanimeweeb27

03-12-2020
Mathematics

contestada

what does the g in 5 = g/8 ?

Respuesta :

03-12-2020

Answer:

UMM WHAT

Step-by-step explanation:

Answer Link

Otras preguntas

How did the Hellenistic kings spread Greek culture

Why do you think James Meredith continued his march, even after he was shot?

Which statement best describes Washington’s economy in the decades following World War II? A. Economic activity flattened and stagnated. B. Economic activity i

How many meters are there in 21 feet?

A circular swimming pool has a diameter of 12 feet. What is the circumference the pool? Use 3.14 to approximate for π . Enter your answer, as a decimal rou

How did the Hellenistic kings spread Greek culture

Each unit on the map represents 5 miles. What is the actual distance from Oceanfront to Seaside? Question 3 options: about 10 miles about 40 miles about 50 mile

-6.8 + (-12) + (-72.3).

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

An employee working in a machine shop is exposed to three different sources which emit noises at 81 dB, 91 dB, and 88 dB. What is the combined noise level expos