vikky85 vikky85
  • 03-12-2020
  • Chemistry
contestada

help with this question

help with this question class=

Respuesta :

vinny1203 vinny1203
  • 03-12-2020
Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:
Answer Link

Otras preguntas

What is the direct object in the sentence? Will you boys try something different now? a. boys b. try c. something d. you
Which form of government, practiced in certain Greek city-states and in the Persian Empire, describes a society ruled by a king or queen until his or her death,
The brain is divided into the _______. A. Cerebrum B. Cerebellum C. Brain stem D. All of the above
The weight of an object on the moon is 1/6 it's weight on Earth. Write 1/6 as a decimal.
what is 3,397 rounded yo the nearest thousand
hubungan ham dengan pancasila
How do you estimate the following question 32 x 43
Subtract. –84 – 55 a. –29 b. –139 c. 29 d. 139
In a restaurant, Chad tracked the number of children and adults that came in over an hour. During that time, 16 children and 40 adults came in the restaurant. W
What is the sign of the product of three integers with the same sign