shukriibrahim36
shukriibrahim36 shukriibrahim36
  • 03-12-2020
  • Biology
contestada

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Respuesta :

keyonaaaaa keyonaaaaa
  • 03-12-2020
I don’t feel like answering all that but....
C=G G=C T=A A=U
Answer Link
vicgraisi1220
vicgraisi1220 vicgraisi1220
  • 03-12-2020
C=G A=T dont know the rest have a gcodocododd dday
Answer Link

Otras preguntas

_______________ decreased the amount of shipping time and increased the amount of farm and merchant goods that could be shipped. A. Airplanes c. River boats b.
4-(3-5)= I need help
Which statement best summarizes the goal of the United States good neighbor policy
can some help with this
What is the area for this triangle?
Please help I’ll mark brainliest
How much heat is released when 47.50 g of CH4 (g) is burned in excess oxygen gas to produce carbon dioxide and water?
Give an example of how a mutation can affect an organism.
how did the US contribute to the allied cause ?
Drag and drop the reasons trade increased during the Middle Ages. A. Food became plentiful. B. Craftspeople made more affordable items. C. Crops were traded am