marciajordan95 marciajordan95

02-11-2020
Mathematics

contestada

Write the sentence as an inequality.
A number n is less than or equal to – 7 or greater than 12

Respuesta :

iceshadow84 iceshadow84

03-11-2020

Answer:

[tex]n\leq -7\\n>12[/tex]

Step-by-step explanation:

Answer Link

Otras preguntas

Based on his background, is Private Burnett's account trustworthy? Why or why not?

Please help me with these English questions 10 points!!! I will give brainliest!!!!! Brainliest to the first person to answer!!!!!!!!!!

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

List five ways people can promote a healthful Environment.

There have been successful information-gathering flybys of other planets such as Mercury, Jupiter, Uranus, and Saturn

1050 households in the town how many own a dog

Which of these increases as greenhouse gas pollution increases? A. Ocean salinity B. Rate of thermohaline circulation C. Ocean surface temperature D. Thickness

At a party, the hosts are giving out door prizes. Each guest receives a numbered ticket and a random drawing will be held for the prizes. There are 14 prizes an

i will give brainliest

World War I resulted in women losing jobs, not accessing new jobs. True or False?