MhizGift
MhizGift
01-11-2020
English
contestada
make a sentence example with the word socialism
Respuesta :
eduardovillafuerte11
eduardovillafuerte11
01-11-2020
Socialism had become a political force in the land. His political and social ideas have had a great influence on the development of socialism in France. Among Canon Barnett's works is Practicable Socialism (1888, 2nd ed. Hope this helps :)
Answer Link
VER TODAS LAS RESPUESTAS ( 23+ )
Otras preguntas
Form the smallest and greatest 4-digit numbers using each of the digits 6,0,7 and 9 only once.
48 ÷ [(13 – 6) — 6°] + 4 - 2 =
Jane estimates this product by computing 7 x 800.What is her estimate?7 X 800 =Bill estimates this product by computing 7 x 900.What is his estimate?7 x 900 = M
A seed was discovered and, when planted, grew to be a large flowering plant. This organism is a single cell that was isolated from the human body, has no nucle
What happened to Queen Elizabeth the 1st that meant many Catholics believed that she could never be queen?
Why would an economist choose either the neoclassical perspective or the Keynesian perspective, but not both?Why would an economist choose either the neoclassic
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
which of the following best fits the overall main idea of the "lets move" campaign?
An extremely small device used in most electronic systems today including computers, telephones, MP3 players, hospital equipment, transportation, and military e
Alaskan Salmon are fished extensively to serve in restaurants. However, there are limits to how many and the size of fish which are allowed to be kept. Generall
