sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

describe 59 in two other ways

why is 24 a more convenient choice than 23 or 25

The length of a rectangle is 50 meters. This is 6 m more than twice the width. Find the width.

numbers like 10;100;1,000 and so on are called

Which of the following statements describes a scientific law? a. A scientific law explains a set of events. b. A scientific law describes what occurs every

name two different numbers that round to 8.21 rounded to the nearest hundred

In which ways did the Meiji Restoration modernize Japanese government and society? Select all that apply. -It appointed the emperor as head of the government. -

Is it true that as long as you read carefully through the instructions for a science activity, you will be safe?

is 3.7 an integer Need help on my math homework plz help

Natalie saved $20 when she purchased a new phone.The phone originally cost $125.What percent savings did Natalie receive on the purchase of the new phone