jeffbestusam
jeffbestusam jeffbestusam
  • 02-09-2016
  • Mathematics
contestada

coefficient of (2x+y^2)^5

Respuesta :

deerica
deerica deerica
  • 06-09-2016
(2x + y2)5 heres you answer your so welcome
Answer Link

Otras preguntas

5. Taxpayer ("T"), a cash basis individual taxpayer, lent money to each of his two daughters ("D1" and "D2") on January 1 of the current yer. T lent $50,000 to
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
Seth and Beth have original investments of $50,000 and $100,000, respectively, in a partnership. The articles of partnership include the following provisions re
(2y^4)^3 fffffffffffffffffffffffffff
the diagram of a circle is 2 feet. what is the radius?
Lula stopped, but she said, “You ain't got no business bringin' white chillun here - they got their church, we got our'n. It is our church, ain't it, Miss Cal?"
Question 1 1 pts True or False? Slavery had always been a major international and transatlantic business since ancient times. True O False
How could poison gas be harmful to the ones using it
Some believe that teen romantic relationships allow adolescents to learn and practice the skills required for forming good adult relationships. Others believe t
Barney has 17 2/3 feet of lumber that he is going to cut into 4 equal pieces for a border on his garden. Which of the following is true?