temmie35
temmie35 temmie35
  • 13-03-2020
  • Mathematics
contestada

Can anyone help me?

Can anyone help me class=

Respuesta :

kevmiller2322ovzitl kevmiller2322ovzitl
  • 13-03-2020

Answer:

First row is 5, second is 6, third is 9 and fourth is 45

Step-by-step explanation:

Answer Link

Otras preguntas

Write about the formation of Himalayas
Which of the following is a run-on sentence?
In the adult, the internal reproductive organs and the urinary bladder are "housed" in which body cavity?
Need Help Fast 33 points please Factor x2 + 10x – 18.
Who was the u.s. general fired during the korean war for trying to create another world war with china?
PLEASE HELP ME !!!!!!!!!! I BEG YOU !!!!!! PLEASE HAVE MERCY !!!!                           Use I = PRT to solve I = $350 P= $700           Find T (T
In the reversible reaction shown below, r moles of a react with s moles of b to produce t moles of c. which equation can be used to represent the equilibrium co
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is the conjugate acid of clo3 −? 1. hclo3 2. clo3 − does not contain oh−, so it is not a base and thus cannot have a conjugate acid. 3. hcl 4. clo− 4 5. h
Can you give me a short summary (only in 1 or 2 sentences) on Shakespeare’s Macbeth. And what it is.