Fredyvallejo Fredyvallejo

03-12-2019
Mathematics

contestada

what is the first step when using order of operations

Respuesta :

x37738x x37738x

03-12-2019

Answer:

If there are parentheses, then you solve what's in those first.

Step-by-step explanation:

Use PEMDAS to help you remember.

P- Parentheses

E- exponents

M- multiplication

D- division

A- addition

S- subtraction

Answer Link

Otras preguntas

For some time, the English had little interest in colonizing for what two reasons?

a jar contains 6 jellybeans, 4 green jellybeans, and 4 blue jelly beans. if we choose a jellybean, then another without putting the first one back in the jar, w

N general, emerging adulthood is a time during which a person functions physically and psychologically at an optimal level.

I’m confused !!! Help

Sugar melts at 367°F. What is the melting point of sugar on the Celsius scale?

The substance in the digestive system that lubricates moistens and protects the surface of the lumen is

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

HELP ASAPIdentify the property used in each step. 12.2 + 18.6 + –4.3 + (–18.6) 12.2 + –4.3 + 18.6 + (–18.6) 12.2 + –4.3 + [18.6 + (–18.6)] 12.2 +

(50)points 5 questions

Why was the Neolithic revolution important