daisy7913 daisy7913

04-09-2019
Chemistry

contestada

What forces typically hold separate molecules together?

Respuesta :

umairihsan2019 umairihsan2019

13-09-2019

Answer:

Intermolecular forces.

Explanation:

Answer Link

Otras preguntas

A transit train from Boston to New York and a passenger train from New York to Boston departed at the same time, at 3:00 PM. The distance between New York stati

Embryological evidence suggests that the echinoderms are closely related to the ______________. arachnids annelids arthropods chordates

A sharp type of pain from the abdomen that travels along neural routes

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Quinn is determining the area of a trapezoid. His work is shown below. mc012-1.jpg Step 1: Break the figure into rectangles and triangles. mc012-2.jpg Step

The small organs used by spiders to produce silk are called _____________. silk nozzles spinnerets pedipalps mouthparts

A right triangle height of 10cm and a hypotenuse of 26cm what is the b

__________ involves a rapid loss that occurs just before death. primary aging pathological aging secondary aging tertiary aging

paul has a standard deck of cards. what is the probability he will choose a 2?

What advice would you give someone whose life dream is to become a judge?