joseberia joseberia
  • 11-04-2019
  • Mathematics
contestada

what is 6/7 - 5/9 just want to know

Respuesta :

GWay
GWay GWay
  • 11-04-2019

Answer:

19/63 or 0.301587

Step-by-step explanation:

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Use factoring to simplify the expression x^2-x-6/x-3 assume that x does not equal 3
At age 76 years, which chronic condition is elizabeth most likely to have?
Which is a classification of emphysema? (select all that apply.) centriacinar parenchyma panacinar paraseptal bullae?
El clima de la costa Guatemalteca es tropical, es decir es ______________________.
Everyone in the neighborhood has been complaining about the deteriorating condition of the park, but nobody has cleaned it up. why not
Adrien needs to use an effective sanitizer to finish cleaning a piece of equipment; he should use a_____ A.sanitizer at a temp of 60F B.sanitizer that has more
Joan is 5 years older than ellen, and 3 years ago the sum of their ages was 17 years. in how many years will joan be 21 years old?
If a car's __________ is malfunctioning, people in the car will become ill when driving long distances, especially if the windows are closed. A. braking system
a trip to the ocean can be a relaxing escape from the everyday pressures of life. A Sailboat glistening on the horizon provides a mental escape to faraway place