01-03-2016
Geography

contestada

How many days toes it take to get to Arizona to New York

Respuesta :

morgan07 morgan07

14-03-2016

If you fly it will take 3.7 hours. If you drive then it will take 38 hours and 4 min.

Answer Link

Otras preguntas

What does the word distribute mean

Katya is training for an upcoming gymnastics competition and needs to improve her upper body strength. At the moment, she can only support at most 180% of her b

You have 4 cards, 2 black and 2 red. You play a game where during each round you draw a card. If it's black, you lose a point. If it's red, you gain a point. Yo

Katherine is shopping for a wedding gown and is on a tight budget. She printed a picture of her dream dress and has all her friends and family looking for a sim

Abraham Lincoln ended his law career when

Plz answer this for me

"Charlotte basically, didn't stop talking as we headed down to the second floor. She was describing the plays they had put on last year, which was Oliver She pl

Information technology's primary role in supply chain management is creating the integrations, or tight process and information linkages, between functions with

A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT 1)25 and 0 2)25 and 25 3)14

An analyst seeks to determine the value of Bulldog Industries. After careful research, the analyst believes that free cash flows for the firm will be $80 millio